CCCGGCAGGUUCUCGUGAUGGCCCAGAGAUAUAGAC
Initializing EVA...
Initializing EVA...
Support for all major RNA types with state-of-the-art generation capabilities powered by our revolutionary MoE architecture.
Ready to design your first RNA sequence?
Start Designing
Trained on the largest and most diverse RNA dataset
Powered by state-of-the-art MoE architecture
State-of-the-art performance across multiple RNA types
Non-coding RNA fitness prediction
Messenger RNA fitness prediction
Precision at both sequence and structure level
Than previous methods
Sequence and Structure
All major RNA types
Generate RNA with precise control over multiple biological properties
Understanding how EVA learns and understands RNA biology
Meet the researchers behind EVA
Connect with us through these platforms
